L’analyse métagénomique des abcès cérébraux identifie des associations bactériennes spécifiques

Contexte La flore bactérienne impliquée dans l’abcès cérébral est souvent complexe Dans une étude précédente, utilisant une approche métagénomique basée sur l’amplification de l’ADN ribosomique 16S, nous avons démontré que la diversité de la flore microbienne impliquée dans ces infections était sous-estimée. Analyse métagénomique des abcès cérébraux des patients diagnostiqués de 2006 à 2010 Toutes les bactéries présentes dans les échantillons d’abcès cérébraux ont été identifiées, compte tenu des caractéristiques cliniques et épidémiologiques des patients. Résultats 51 patients ont été inclus dans notre étude En détectant des infections polymicrobiennes chez 19 patients, notre stratégie était significativement plus discriminatoire et permettait l’identification d’un plus grand nombre de taxons bactériens que la culture et la réaction PCR en chaîne de l’ADNr 16S conventionnelle et le séquençage, respectivement P & lt; 10-2 Data mining a distingué 2 populations bactériennes distinctes dans les abcès cérébraux d’origine dentaire et sinusale De plus, parmi les 80 espèces bactériennes détectées, nous avons identifié 44 bactéries qui n’avaient jamais été trouvées dans des spécimens d’abcès cérébral, dont 22 non cultivées. provenait des flores buccales ou sinusales P & lt; 10-2 et ont été trouvés dans des échantillons polymicrobiens P & lt; 10-2Conclusions Le clonage et le séquençage de l’ADNr 16S amplifié par PCR est une méthode très utile pour identifier les agents bactériens des abcès cérébraux

Les abcès cérébraux sont des infections focales résultant de l’extension directe d’un foyer contigu suppuratif sinus, de l’oreille moyenne, ou des mastoïdes dans 25% -50% des cas [1-3], de la diffusion hématogène d’un foyer éloigné dans 15% -30% de cas [1, 2], et d’inoculation directe traumatisme ou neurochirurgie dans 8% -19% des cas [4] Dans 20% -30% des cas, aucune source ne peut être identifiée [2, 3] Malgré les progrès diagnostiques et neurochirurgicaux procédures, la mortalité de cette maladie reste élevée 8% -32% [5-8], et des séquelles sont observées chez 9% -36% des patients [4, 7, 9] Actuellement, la détection des pathogènes bactériens dans les abcès cérébraux est La culture de pus reste stérile dans 9% -63% des cas [5, 9, 12] Au cours de la dernière décennie, l’amplification et le séquençage de l’ADN ribosomique 16S ont été couronnés de succès. utilisé pour détecter les bactéries dans les spécimens d’abcès cérébraux [13-15] Cependant, cette méthode a été altérée en cas de p En revanche, des études métagénomiques sur des flores humaines complexes en combinant la réaction en chaîne de l’ADN polymérase 16S PCR et le séquençage par clonage de produits de PCR se sont avérées utiles pour évaluer la diversité bactérienne de la flore microbienne. flores dentaires, vaginales et intestinales [17-22] Dans une étude précédente, nous avons appliqué une telle approche aux spécimens d’abcès cérébraux [23]. Cette étude préliminaire a identifié 49 agents bactériens abcès cérébraux distincts et permis l’identification de 27 bactéries jamais détectées auparavant. abcès cérébral, dont 15 étaient incultes [23-25] Un nombre aussi élevé d’espèces bactériennes impliquées dans l’abcès cérébral a incité l’étude de 51 nouveaux spécimens dans le but de décrire davantage la flore associée aux abcès cérébraux et à leurs étiologies.

PATIENTS ET MÉTHODES

Patients et échantillons cliniques

Un abcès cérébral a été défini comme une lésion suppurative intracérébrale localisée pour laquelle l’analyse histologique a confirmé la présence de pus et exclu la présence de cellules cancéreuses et lymphomateuses. Échantillons de pus d’abcès cérébral prélevés chirurgicalement chez 51 patients des hôpitaux de Marseille et Nice. ont été collectés en utilisant des conditions chirurgicales stériles et immédiatement envoyés au laboratoire de bactériologie L’étude a été approuvée par le comité d’éthique local sous la référence 07-030

Culture

Les échantillons de pus ont été examinés au microscope après coloration de Gram Les échantillons ont ensuite été étalés sur des plaques de gélose au sang et au chocolat BioMérieux et incubés à 37 ° C dans des atmosphères aérobies et anaérobies Les plaques ont été examinées quotidiennement pendant 10 jours. et bandes d’identification API BioMérieux Lorsque l’identification phénotypique a échoué, les isolats ont été identifiés en utilisant le séquençage de l’ADNr 16S comme décrit ailleurs [26]

Amplification et séquençage classiques de l’ADNr 16S rDNA et 18S rDNA

L’ADN a été extrait de chaque échantillon comme décrit ailleurs [23] L’ADNr 16S et l’ADNr 18S ont été amplifiés en utilisant les paires d’amorces fD1-rp2 et CUF-CUR, respectivement Tableau 1, comme décrit ailleurs [23] On a purifié les produits PCR 16S rDNA ou ADNr 18S en utilisant le kit PCR NucleoFast 96 Macherey-Nagel selon les recommandations du fabricant. Les réactions de séquençage ont été réalisées en utilisant le cycle Big-Dye Terminator. kit de séquençage DNA version 11; PerkinElmer selon les instructions du fabricant Les produits PCR 16S rDNA ont été séquencés dans les deux directions en utilisant les amorces internes 536f, 536r, 800f, 800r, 1050f et 1050r, tandis que les amplicons 18S ont été séquencés en utilisant les amorces PCR. un analyseur génétique ABI Prism 3130x Applied Biosystems, Les différents fragments ont été assemblés à l’aide du logiciel Sequencher version 40 Applied Biosystems Les séquences obtenues ont été comparées à celles de la base de données GenBank http: // wwwncbinlmnihgov / genbank / en utilisant le logiciel BLAST http: // blastncbinlmnihgov

Tableau 1 Séquence des amorces utilisées pour la réaction en chaîne de la polymérase et séquence de séquençage, amorce ou nom de sonde 5 ‘→ 3′ amplification du gène de l’ADNr 16S et séquençage fD1 AGA GTT TGA TCC TGG CTC AG rp2 ACG GCT ACC TTG TTA CGA CTT 16S séquençage de l’ADN 536rr GTA TTA CCG CCG CTG CTG 536f CAG CAG CCG CCG TAA TAC 800f TAG ATA TAC CCG GTT AG 800r CTA CCA GGG TAT CTA à 1050r CAC GAG CTG ACG ACA 1050f 5’-TGT CGT CAG CTC GTG Amplification des inserts M13d CAG GAA ACA GCT ATG AC M13r GTA AAA CGA CGG CCA G amplification du gène β-globine KM29 GGT TGG CCA ATC TAC TCC CAG G RS42 GCT CAC TCA GTG TGG CAA AG 18S amplification et séquençage du gène de l’ADNr CUF TCCGTAGGTGAACCTGCGG CUR GCTGCGTTCTTCATCGATGC Séquence, amorce ou nom de sonde 5 ‘ → Amplification du gène de l’ADNr 3S 16 ‘et séquençage fD1 AGA GTT TGA TCC TGG CTC AG rp2 ACG GCT ACC TTG TTA CGA CTT 16S séquençage de l’ADNr 536r GTA TTA GCC CCG CTG CTG 536f CAG CAG CCG CCG TAA TAC 800f TAG ATA TAC CCG GTT AG 800r CTA CCA GGG TAT CTA à 1050r CAC GAG CTG ACG ACA 1050f 5’-TGT CGT CAG CTC GTG amplification de l’insert M13d CAG GAA ACA GCT ATG AC M13r GTA AAA CGA CGG CCA G β-globine amplification du gène KM29 GGT TGG CCA ATC TCC TCC CAG G RS42 GCT CAC TCA GTG TGG CAA AG Amplification et séquençage du gène de l’ADNr 18S CUF TCCGTAGGTGAACCTGCGG CUR GCTGCGTTCTTCATCGATGC Abréviation: ADNr, ADN ribosomique Large

Clonage et séquençage de l’ADNr 16S

Les produits PCR positifs 16S rDNA ont été clones en utilisant le système pGEM-T Easy Vector avec JM109 Escherichia coli compétent selon les instructions du fabricant Promega Pour chaque échantillon, 100 colonies blanches ont été prélevées et leur ADN amplifié par PCR individuellement en utilisant le M13d et M13r amorces Tableau 1 Le séquençage a été effectué comme décrit ci-dessus en utilisant les amorces 536r, 536f, 800f, 800r, 1050f et 1050r Tableau 1 Le pyroséquençage, utilisé ailleurs pour l’étude métagénomique des abcès cérébraux [23], mais long et coûteux, utilisé dans cette étude

Analyse des données et identification des taxons

Les séquences obtenues à partir de chaque clone ont été comparées à celles de la base de données GenBank à l’aide du logiciel BLAST. Un niveau de similarité de 987% a été utilisé pour identifier les espèces [27] II [28] et les séquences complètes de gènes de l’ADNr 16S rejetés de nouveaux phylotypes ont été déposées dans GenBank sous les numéros d’accession énumérés dans le tableau 3

Analyse de données

Les données des 51 patients de cette étude et des 20 patients de notre précédente étude [23] ont été analysées avec la version 170 du logiciel PASW Statistics; PASW Statistics et le logiciel PASW Modeler version 14; PASW Statistics Une analyse univariée a été effectuée pour détecter des associations statistiquement significatives entre les résultats de clonage, la maladie sous-jacente et les microorganismes identifiés. Les tests de Mantel-Haenszel ou de Fisher ont été utilisés en fonction des valeurs attendues des cellules. La valeur AP exacte de l’essai & lt; 05 était considérée comme significative

Data Mining

Le composant de noeud Auto Cluster du PASW Statistics PASW a été utilisé pour estimer et comparer des modèles de cluster, qui identifient des groupes d’enregistrements présentant des caractéristiques similaires sans bénéficier de connaissances préalables sur les groupes et leurs caractéristiques. relativement petit nombre de patients et de microorganismes, ceux-ci ont été regroupés par genre ou groupe de bactéries bactéries non cultivées, autres anaérobies, autres streptocoques, autres staphylocoques, entérobactéries et β-protéobactéries, et ceux isolés une seule fois ont été omis

RÉSULTATS

Donnée clinique

Les 51 nouveaux patients étudiés comprenaient 37 hommes 72% et 14 femmes 28% Quarante-six étaient des adultes et 5 étaient des enfants L’âge des patients variait de 9 mois à 87 ans L’âge, le sexe, et les données épidémiocliniques des patients sont détaillés dans le tableau 2 En résumé, l’abcès s’est développé de façon contiguë après sinusite chronique chez 11 patients 215%, otite moyenne chez 6 patients 117%, infection dentaire ou traitement chez 6 patients 11% et neurochirurgie chez 7 patients 137% Abcès développé chez 4 patients atteints de cancer 78 %, chez 3 patients immunodéprimés 59% et chez 11 patients présentant diverses pathologies 215% Aucune source primaire n’a été identifiée chez 3 patients 59% Un diagnostic microbiologique a été réalisé chez 43 patients Tableau 2

terium acnes P acnes P acnes 100 4 Mâle 50 ND Non M Haemophilus parainfluenzae H parainfluenzae H parainfluenzae 100 5 Femelle 51 C Non M Streptococcus intermedius S intermedius S intermedius 100 6 Mâle 56 B Non K P acnes P acnes P acnes 100 7 Mâle 55 ND Non N Staphylococcus aureus S aureus S aureus 100 8 Femelle 87 B Oui L P acnés P acnes P acnes 100 9 Mâle 38 ND Oui L Aucun Streptococcus pneumoniae S pneumoniae 100 10 Féminin 56 ND Oui O Enterobacter cloacae E cloacae E cloacae 57, Enterobacter hormaechei 40, Escherichia coli 3 11 Féminin 25 B Non O P acnés P acnés P acnes 100 12 Mâle 41 C Non L S intermédiaire, Haemophilus aphrophilus S intermédiaire S intermédiaire 70, H aphrophilus 30 13 Féminin 81 ND Oui K Prevotella héparinolytique, Campylobacter rectus Polymicrobien P héparinolytique 96, Fusobacterium nucleatum 4 14 Mâle 57 ND Non P Nocardia abscessus N abcès N abcès 95, Burkholderia cenocep acia 3, Stenotrophomonas maltophilia 2 15 Femelle 1 ND Oui L Aucune S pneumoniae S pneumoniae 100 16 Homme 40 B- Non R Entérocoque aviaire, Proteus mirabilis, Bacteroides fragilis Polymicrobien Porphyromonas endodontalis 18, Porphyromonas asaccharolytica 2, Peptostreptococcus stomatis 8, M micros 12, Enterococcus raffinosus 2, Catonella morbi 1, B fragilis 30, Bacteroides thetaiotaomicron 12, Bilophila wadsworthia 8%, BA20 1 non cultivé, BA21 3 non cultivé, BA22 2 non cultivé, BA23 non cultivé 1 17 Homme 60 B- Non O Kleibsiella pneumoniae K pneumoniae K pneumoniae 100 18 Mâle 70 ND Non P Aucunb Aucun ND 19 Mâle 70 B- Non K Citrobacter koseri C koseri C koseri 100 20 Féminin 61 C Oui Q S intermédiaire S intermédiaire S intermédiaire 100 21 Mâle 73 ND Non S Aucun Nonea ND 22 Mâle 54 ND Non M H aphrophilus H aphrophilus H aphrophilus 95, F nucléeatum 5 23 Mâle 35 B- et C Non M Staphylococcus epidermidis Polymicrobien S intermed ius 2, F nucleatum 65, Campylobacter gracilis 6, Fusobacterium meyeri 6, M micros 17, non cultivé BA24 4 24 Féminin 20 B- Oui O E coli E coli E coli 25 Mâle 48 ND Non T Rien Rien ND 26 Féminin 69 C Oui M Aucune S intermedius S intermedius 100 27 Mâle 57 ND Non P Aucun Nocardia carnea N carnea 100 28 Mâle 62 ND Oui M Aucun Polymicrobien Tannerella forsythensis 20, F nucléaste 50, P endodontale 11, Dialister pneumosintes 13, P acnes 2, Eubacterium brachy 1, Filifactor alocis 1, non cultivé BA25 1, non cultivé BA26 1 29 Mâle 44 ND Non O Rien Rien ND 30 Mâle 14 C Non M S intermédiaire S intermédiaire S intermédiaire 93, H aphrophilus 4, F nucléaste 3 31 Mâle 12 C Oui L S pneumoniae S pneumoniae S pneumoniae 100 32 Homme 69 ND Non J Aucun Aucun ND 33 Féminin 75 ND Oui U Aucun Néant ND 34 Mâle 26 ND Oui O E cloacae Enterobacter espèce E hormaechei 98, E cloacae 1, Tepidimonas arfidensis 1 35 Mâle 70 ND Oui V Aucune Aucune ND 36 Féminin 44 ND Non O Rien Rien ND 37 Féminin 69 ND Non V Aucun Néant ND 38 Mâle 55 ND Oui L S pneumoniae S pneumoniae S pneumoniae 100 39 Mâle 23 ND Non I Néant Nonea ND 40 Mâle 38 C Non W S intermedius S intermédiaire S intermedius 61, M micros 31, E brachy 5, F nucleatum 3 41 mâle 42 C non J aucun Polymicrobien C rectus 1, Treponema maltophilum 1, Bacteroides héparinolyticus 15, Porphyromonas gingivalis 33, Fusobacterium alocis 27, F nucléeatum 9, Eubacterium nodatum 4, Campylobacter showae 2, inculte BA27 8 42 Mâle 54 ND Oui O Aucun Polymicrobien Clostridium cllostridiforme 27, Massilia timonae 15, BA28 non cultivé, Streptococcus parasanguinis 8, Pseudomonas trivialis 10, Micrococcus luteus 3, Enhydrobacter aerosaccus 1, Petrobacter succinimandens 1 BA29 12 non cultivé BA30 1 non cultivé BA31 13 43 Mâle 58 C Non M S constellatus F nucléaste F nucléaste 95, H aphrophilus 5 44 Féminin 84 ND Non V Aucun Néant ND 45 Mâle 54 ND Oui J Aucun S intermédiaire S intermédiaire 100 46 Mâle 65 ND Non J Aucun S intermédiaire S intermedius 67, M micros 34, inculte BA32 7 47 Femelle 9 mois C Non X S aureus S aureus S aureus 100 48 Mâle 15 C Non M S intermédiaire, S epidermidis S intermédiaire S intermedius 99, Pseudomonas lutae 1 49 Mâle 36 C Non O S aureus S aureus S aureus 100 50 Mâle 47 C Non M S intermédiaire, H aphrophilus S intermédiaire S intermédiaire 97, M micros 3 51 Mâle 62 C Non J S intermédiaire S intermédiaire S intermédiaire 95, M faucium 5 Abréviations: B, bacilles Gram positif; B-, bacilles à Gram négatif; C, cocci à Gram positif; I, virus de l’immunodéficience humaine positif; J, infection dentaire; K, infection des métastases cérébrales du cancer; L, otite moyenne; M, sinusite chronique; N, fracture de la base du crâne et rhinorrhée du liquide céphalo-rachidien; ND, pas fait; O, chirurgie du cerveau au cours du dernier mois; P, receveur de greffe rénale; Q, pneumonie pulmonaire droite; R, diverticulite colique; ADNr, ADN ribosomique; S, l’arthrite rhumatoïde traitée avec le rituximab; T, l’encéphalite herpétique simplex; U, pyélonéphrite aiguë; V, aucun facteur de risque identifié; W, traitement dentaire avant la chirurgie cardiaque; X, chirurgie post-cardiaque; Y, bactériémie associée au cathéter veineuxToxoplasmose positive par l’ADNr 18S réaction en chaîne de la polymérasebScedosporium apiospermium infection positive par l’ADNr 18S réaction en chaîne de la polymérase View Large

Culture

Les microorganismes étaient visibles au microscope dans 23 échantillons 451%; La table 2 Culture était positive dans 30 patients 59%; Tableau 2 Parmi ces patients, 25 patients ont été infectés avec 1 espèce de bactéries, 4 avec 2 espèces de bactéries et 1 avec 3 espèces de bactéries Tableau 2 Globalement, 18 espèces différentes ont été détectées par culture

PCR conventionnelle et séquençage

Tous les 51 échantillons testés étaient positifs à la PCR par amplification de la β-globine, 39 étaient positifs pour l’ADNr 16S et 4 étaient positifs pour l’ADNr 18S Les contrôles négatifs sont restés négatifs dans toutes les expériences PCR Dans 7 échantillons, le séquençage de l’ADNr 16S a identifié des infections polymicrobiennes Dans 32 échantillons, une seule espèce de bactérie a été détectée par séquençage d’ADNr 16S Dans l’ensemble, 14 espèces différentes ont été identifiées par séquençage d’ADNr 16S conventionnel Tableau 2 Par PCR 18S rADN, Toxoplasma gondii a été identifié dans des échantillons de 3 patients et Scedosporium apiospermium identifié dans un échantillon de 1 patient Tableau 2

Analyse métagénomique basée sur l’ADNr 16S

Les 39 échantillons positifs à la PCR ont été clonés et analysés. Des infections polymicrobiennes ont été détectées dans 19 échantillons. Parmi ceux-ci, le nombre d’espèces bactériennes détectées variait de 1 à 14. Dans les 20 échantillons monomicrobiens, le clonage identifiait la même bactérie que le séquençage classique de l’ADNr 16S. , 76 espèces différentes ont été identifiées, dont 23 présentaient la plus grande similitude de séquence avec des bactéries non cultivées. Tableaux 2 et 3 Parmi les 76 espèces identifiées, 44 n’avaient pas encore été identifiées dans les abcès cérébraux, dont 22 espèces validées et 22 non cultivées détection.

ter vitae Protéobactéries 1/2 Filifactor alocis Firmicutes 1/1 Catonella morbi Firmicutes 1/1 Pseudomonas lutea Protéobactéries 1/1 Enhydrobacter aerosaccus Protéobactéries 1/1 Petrobacter succinimandens Protéobactéries 1/1 Tepidimonas arfidensis Protéobactéries 1/1 BA10 non cultivé GU592680 Bacteroidetes non cultivé BA11 GU592681 Bacteroidetes BA12 non cultivé BA59 GU592682 Bacteroidetes non cultivé BA13 GU592683 Firmicutes 1/1 non cultivé BA14 GU592684 Synergistetes 1/1 non cultivé BA15 GU592685 Firmicutes 1/2 non cultivé BA16 GU592686 Bacteroidetes 1/1 non cultivé BA17 GU592687 Bacteroidetes 1/8 non cultivé BA18 GU592688 Bacteroidetes 1/8 non cultivé BA19 GU592689 Bacteroidetes 1/3 Unicultured BA20 GU592690 Firmicutes 1/1 Uncultured B A22 GU592692 Firmicutes 1/1 non cultivé BA23 GU592693 Firmicutes 1/1 non cultivé BA24 GU592694 Protéobactéries 1/2 BA25 non cultivé GU592694 Bacteroidetes 1/1 BA6 non cultivé GU592696 Bacteroidetes 1/2 BA27 non cultivé GU592697 Firmicutes 1/1 non cultivé BA28 GU592698 Firmicutes 1/4 BA29 non cultivé GU592699 Firmicutes 1/1 non cultivé BA30 GU592700 Bacteroidetes 1/1 non cultivé BA31 GU592701 Protéobactéries 1/8 non cultivé BA32 GU592702 Firmicutes 1/9 Espèces Nom Phylum Nombre de patients / Nombre de clones Taxons signalés précédemment GenBank accession non Streptococcus intermedius Firmicutes 11/890 Fusobacterium nucleatum Fusobactéries 8/234 Micros micronas Firmicutes 6/139 Propionibacterium acnes Actinobactéries 5/402 Streptococcus pneumoniae Firmicutes 4/400 Haem ophilus aphrophilus Protéobactéries 4/134 Staphylococcus aureus Firmicutes 3/300 Escherichia coli Protéobactéries 2/103 Enterobacter cloacae Protéobactéries 2/58 Porphyromonas endodontalis Bacteroidetes 2/29 Eubacterium brachy Firmicutes 2/6 Citrobacter koseri Protéobactéries 1/100 Haemophilus parainfluenzae Protéobactéries 1/100 Kleibsiella pneumoniae Protéobactéries 1/100 Nocardia abscessus Actinobactéries 1/95 Porphyromonas gingivalis Bacteroidetes 1/33 Streptococcus constellatus Firmicutes 1/30 Bacteroides fragilis Bacteroidetes 1/30 Prevotella baroniae Bacteroidetes 1/18 Dialister pneumosintes Firmicutes 1/13 Prevotella oris Bacteroidetes 1/12 Prevotella buccae Bacteroidetes 1 / 10 Peptostreptococcus stomatis Firmicutes 1/8 Bilophila wadsworthia Protéobactéries 1/8 Campylobacter gracilis Protéobactéries 1/6 Actinomyces meyeri Actinobactéries 1/6 Micrococcus luteus Actinobactéries 1/3 Stenotrophomonas maltophilia Protéobactéries 1/2 Campylobacter rectus Protéobactéries 1/1 Mycoplasma faucium Tenericutes 1/5 Treponema maltophilum Spirochètes 1/1 Non cultivé BA21 GU592691 Firmicutes 1/3 Taxons non déclarés précédemment GenBank accession non Enterobacter hormaechei Protéobactéries 3/138 Nocardia carnea Actinobactéries 1/100 Prevotella héparinolytica Bacteroidetes 1/96 Clostridium clostridiforme Firmicutes 1/27 Fusobacterium alocis Firmicutes 1/27 Tannerella forsythensis Bacteroidetes 1/20 Massilia timonae Protéobactéries 1/15 Bacteroides heparinolyticus Bacteroidetes 1/15 Bacteroïdes thétaiotaomicron Bacteroidetes 1/12 Pseudomonas trivialis Protéobactéries 1/10 Streptococcus parasanguinis Firmicutes 1/8 Eubacterium nodatum Firmicutes 1/4 Burkholderia cenocepacia Protéobactéries 1/3 Porphyromonas asaccharolytica Bacteroidetes 1/2 Enterococcus raffinosus Firmicutes 1/2 Campylobacter showae Protéobactéries 1/2 Filifactor alocis Firmicutes 1/1 Catonella morbi Firmicutes 1/1 Pseudomonas lutea Protéobactéries 1/1 Enhydrobacter aerosaccus Protéobactéries 1/1 Petrobacter succinimandens Protéobactéries 1/1 Tepidimonas arfidensis Protéobactéries 1/1 Non cultivé BA10 GU592680 Bacteroidetes non cultivé BA11 GU592681 Bacteroidetes non cultivé BA12 GU592682 Bacteroidetes non cultivé BA13 GU592683 Firmicutes 1/1 BA14 non cultivé GU592684 Synergistetes 1/1 BA15 non cultivé GU592685 Firmicutes 1/2 BA16 non cultivé GU592686 Bacteroidetes 1/1 non cultivé BA17 GU592687 Bacteroidetes 1/8 non cultivé BA18 GU592688 Bacteroidetes 1/8 non cultivé BA19 GU592689 Bacteroidetes 1/3 non cultivé BA20 GU592690 Firmicutes 1/1 non cultivé BA22 GU592692 Firmicutes 1/1 non cultivé BA23 GU592693 Firmicutes 1/1 non cultivé BA24 GU592694 Proteobacteria 1/2 BA25 non cultivé GU592694 Bacteroidetes 1/1 BA6 non cultivé GU592696 Bacteroidetes 1/2 BA27 non cultivé GU592697 Firmicutes 1/1 non cultivé BA28 GU592698 Firmicutes 1/4 non cultivé BA29 GU592699 Firmicutes 1/1 non cultivé BA30 GU592700 Bacteroidetes 1/1 non cultivé BA31 GU592701 Proteobacteria 1/8 non cultivé BA32 GU592702 Firmicutes 1/9 aLes taxons bactériens ont été classés selon leur identification antérieure dans les abcès cérébraux de la littérature scientifique.

Comparaison entre les méthodes de diagnostic

Dans les 22 échantillons, les bactéries identifiées étaient identiques en utilisant la culture et le séquençage classique de l’ADNr 16S. Les 8 autres échantillons positifs pour la culture incluaient 4 échantillons qui étaient polymicrobiens en utilisant l’ADNr 16S, dont 3 seulement 1 2 espèces bactériennes cultivées ont été détectées par PCR et 1 dans lesquelles les bactéries cultivées Streptococcus constellatus différaient de celles détectées par PCR Fusobacterium nucleatum Douze échantillons étaient négatifs en utilisant à la fois PCR et culture Tableau 2 Neuf échantillons étaient positifs à la PCR mais négatifs à la culture, y compris 3 Tableau 2Toutes les espèces bactériennes détectées en utilisant le séquençage de l’ADNr 16S classique ont été récupérées en utilisant le clonage et le séquençage de l’ADNr 16S En revanche, les bactéries détectées par culture de 6 échantillons n’ont pas été détectées par clonage, incluant Enterococcus avium et Proteus mirabilis dans 1 spécimen; Staphylococcus epidermidis chez 2 spécimens; et S constellatus, Campylobacter rectus et Haemophilus aphrophilus dans 1 spécimen chaque Tableau 2 Dans l’ensemble, 80 taxons bactériens ont été identifiés dans cette étude, dont 76 détectés par clonage et séquençage de l’ADNr 16S 95%, dont 59 non détectés par les autres méthodes 737 % Tableau 2 Le clonage et le séquençage ont identifié significativement plus d’échantillons polymicrobiens que la culture 19 de 51 spécimens contre 5 de 51 spécimens; P & lt; 10-2 et séquençage conventionnel 19 sur 51 spécimens contre 7 sur 51 spécimens; P & lt; 10-2 En outre, le clonage et le séquençage ont détecté significativement plus de taxons bactériens que la culture 76 sur 80 spécimens contre 18 sur 80 spécimens; P & lt; 10-2 et séquençage conventionnel 76 sur 80 spécimens contre 14 sur 80 spécimens; P & lt; 10-2

Identification des fleurs spécifiques à une maladie

La combinaison des données de 71 patients 51 de la présente étude et 20 de notre précédente étude [23] a permis l’identification de plusieurs associations. L’analyse univariée a démontré une association significative entre les infections monomicrobiennes et l’otite moyenne 6 sur 29 échantillons vs 2 sur 42; P = 04; entre les infections polymicrobiennes et la sinusite ou les défauts dentaires 18 sur 29 spécimens contre 6 sur 42 spécimens; P & lt; 10-2; et entre les infections polymicrobiennes et les espèces Streptococcus, les espèces Prevotella, les espèces Peptostreptococcus, les espèces Staphylococcus, les espèces Campylobacter, les espèces Fusobacterium, les espèces Porphyromonas, les autres anaérobies, Mycoplasma faucium et les bactéries non cultivées P ≤ 02 pour tous les microorganismesOtitis media était associé à Streptococcus pneumoniae 4 of 6 spécimens contre 0 sur 65 spécimens; P & lt; 10-2 La sinusite ou anomalie dentaire était associée aux espèces Streptococcus, Prevotella, Peptostreptococcus, Streptococcus intermedius, Campylobacter species, Fusobacterium species, autres anaérobies, M faucium et bactéries non cultivées P ≤ 04 pour tous les microorganismes. La chirurgie du cerveau était associée aux entérobactéries et β-protéobactéries 5 sur 12 spécimens contre 7 sur 59 spécimens; P = 02, et l’immunodéficience était associée à la toxoplasmose et aux espèces de Nocardia 6 sur 10 spécimens contre 0 sur 61 spécimens; P & lt; 10-2Le noeud PASl du modéliseur PASW a trouvé que les grappes de nœuds K-means étaient la méthode qui donnait les meilleurs résultats pour l’identification des grappes dans la base de données. La méthode K-means classait les patients en 4 groupes selon les données démographiques et cliniques. Ainsi, selon les microorganismes isolés ou en association Tableau 4 Le premier groupe comprenait 49 69% des patients, le deuxième 18,25% des patients, le troisième 3,22% des patients et le quatrième un seul patient. Dans le groupe 2, la plupart des patients avaient subi une sinusite ou des traitements dentaires et avaient des infections polymicrobiennes, y compris des bactéries non cultivées dans seulement 39% des cas. Les micro-organismes les plus fréquemment identifiés étaient: Espèces de Peptostreptococcus, espèces de Fusobacterium et S intermedius Dans le groupe 3, la plupart des patients avaient également souffert de sinus Ils différaient des patients du groupe 2 par la présence systématique d’espèces Bacteroides et de bactéries non cultivées, et celle de M faucium et Enterobacteriaceae chez 2 des 3 patients. Le groupe 4 était constitué d’un seul patient qui se développait, suivant le cerveau. chirurgie, une infection polymicrobienne faite de bactéries appartenant à au moins 5 genres et / ou espèces différents Aucun lien statistique n’a pu être établi entre ces groupes microbiens et les caractéristiques cliniques ou épidémiologiques

Tableau 4 Classification des 71 patients selon l’analyse de l’extraction de donnéesa Groupe variable 1 N = 49 [69] Groupe 2 N = 18 [254] Groupe 3 N = 3 [42] Groupe 4 N = 1 [14] Microorganismes β-Protéobactéries 1 2 0 0 0 0 1 100 espèces de Bacteroides 0 0 0 0 3 100 0 0 espèces d’Enterobacteriacae 6 12 1 6 2 67 0 0 espèces de Fusobacterium 1 2 12 67 1 33 0 0 espèces de Micrococcus 0 0 0 0 0 0 100 Mycoplasma faucium 0 0 2 11 2 67 0 0 Autres anaérobies 0 0 5 28 1 33 1 100 Espèces de Peptostreptococcus 0 0 11 61 1 33 0 0 Espèces de Porphyromonas 0 0 3 17 1 33 0 0 Espèces de Pseudomonaceae 0 0 0 0 0 0 100 Espèces de Pseudomonas 0 0 1 6 0 0 1 100 Streptococcus intermedius 8 16 10 56 1 33 0 0 Bactéries non cultivées 0 0 7 39 3 100 1 100 Infection polymicrobienne 7 143 18 100 3 100 1 100 Données démographiques et cliniques Âge moyen, années 496 504 487 54 Sexe masculin 33 67 16 89 3 100 1 100 Chirurgie du cerveau 10 20 0 0 0 0 100 Sinusite ou traitement dentaire 6 12 16 89 2 67 0 0 Variable Groupe 1 N = 49 [69] Groupe 2 N = 18 [254] Groupe 3 N = 3 [42] Groupe 4 N = 1 [14] Microorganismes β-Protéobactéries 1 2 0 0 0 0 100 Espèces de Bacteroides 0 0 0 0 3 100 0 0 Enterobacteriacae espèces 6 12 1 6 2 67 0 0 Espèces de Fusobacterium 1 2 12 67 1 33 0 0 Espèces de Micrococcus 0 0 0 0 0 0 100 Mycoplasma faucium 0 0 2 11 2 67 0 0 Autres anaérobies 0 0 5 28 1 33 1 100 Peptostreptococcus espèces 0 0 11 61 1 33 0 0 Espèces de Porphyromonas 0 0 3 17 1 33 0 0 Espèces de Pseudomonaceae 0 0 0 0 0 0 100 Espèces de Pseudomonas 0 0 1 6 0 0 1 100 Streptococcus intermedius 8 16 10 56 1 33 0 0 Bactéries non cultivées 0 0 7 39 3 100 1 100 Infection polymicrobienne 7 143 18 100 3 100 1 100 Données démographiques et cliniques Âge moyen, années 496 504 487 54 Sexe masculin 33 67 16 89 3 100 1 100 Chirurgie du cerveau 10 20 0 0 0 0 1 100 Sinusite ou traitement dentaire 6 12 16 89 2 67 0 0 aLes données ne sont pas% des patients, sauf indication contraire Les 8 patients pour lesquels aucune étiologie n’a été identifiée étaient tous inclus dans le groupe 1

DISCUSSION

En outre, le pouvoir discriminant parmi les taxons du séquençage de l’ADNr 16S conventionnel est limité dans les flores complexes, donnant souvent des séquences non interprétables, comme décrit ailleurs pour les spécimens d’abcès du cerveau [13, 15]. 6 espèces bactériennes ont été cultivées mais non détectées par clonage Ces bactéries étaient C rectus, E avium, P mirabilis, S epidermidis, H aphrophilus et S constellatus. Une telle divergence peut résulter de biais dans le clonage et le séquençage des gènes de l’ADNr 16S. il est peu probable que la lyse cellulaire [30] et les méthodes d’extraction et de purification d’ADN utilisées, choix des amorces [31], PCR [32, 33] et conditions de clonage [34], notamment la large gamme d’amorces utilisées toutes les bactéries présentes dans un échantillon polymicrobien En outre, comme l’ADN de toutes les bactéries d’un échantillon est en compétition pour les mêmes réactifs, ceux présents aux plus faibles concentrations pourraient être sous-amplifiés dans la PCR [35, 36]. , le nombre de clones séquencés peut ne pas permettre la caractérisation de tous les taxons bactériens présents dans les échantillons polymicrobiensNotre stratégie nous a permis de détecter 44 espèces de bactéries 564% qui n’avaient pas été identifiées auparavant dans les abcès cérébraux Des résultats similaires ont été obtenus abcès cérébral, infections endodontiques, caries et parodontites dentaires, infections pulmonaires [21-23, 37, 38], démontrant ainsi la puissance des études métagénomiques pour caractériser les flores complexes. De plus, l’exploration de données et les analyses statistiques ont démontré une forte association d’immunodéficience avec toxoplasmose et nocardiose P & lt; 10-2; de la chirurgie du cerveau avec Enterobacteriaceae et β-proteobacteria P = 02; d’infections monomicrobiennes, principalement par S pneumoniae, avec otite P = 04; et d’infections polymicrobiennes avec sinusite ou malformations dentaires P & lt; 10-2 Ces données suggèrent que les abcès cérébraux otogènes peuvent être traités empiriquement avec des antibiotiques antipneumococciques, alors que ceux associés aux maladies dentaires ou à la sinusite doivent être traités avec le traitement empirique habituel des abcès cérébraux, y compris un β-lactame et un métronidazole. avec sinusite ou traitement dentaire, 2 groupes microbiens ont été identifiés Tableau 4, dont un fait de Peptostreptococcus espèce, Fusobacterium espèce et / ou S intermedius mais pas de bactéries non cultivées, et un second groupe constitué de Bacteroides espèces, bactéries non cultivées, M faucium, et Enterobacteriaceae Bien que nous reconnaissions le fait que le nombre de patients dans les deux groupes est faible, nous ne nous attendions pas à identifier des associations microbiennes distinctes dans les abcès cérébraux après sinusite ou traitements dentaires. Nous n’avons trouvé aucune spécificité épidémiologique ou clinique associée à ces populations microbiennes. une telle constatation peut n’avoir aucune incidence sur la gestion de patients, car l’association d’un β-lactame et de métronidazole peut couvrir la plupart des microorganismes identifiés dans ces 2 groupes de patients. Des 23 séquences correspondant à celles des bactéries non cultivées, décrites comme appartenant à la microflore parodontale ou intestinale, 1 BA21 non cultivé a été détecté. précédemment dans un abcès cérébral [23] Les bactéries non cultivées, dont 10 espèces Bacteroidetes 435% et 9 espèces Firmicutes 391%, ont été détectés à partir de 7 spécimens et significativement associés à des flores polymicrobiennes P & lt; 10-2, en particulier chez les patients présentant des facteurs de risque sinusaux ou dentaires P & lt; 10-2, soulignant ainsi la diversité sous-estimée des pathogènes potentiels dans cette flore Nos données sont en accord avec les études métagénomiques antérieures de la flore buccale, dans lesquelles il a été estimé qu’environ 50% des bactéries sont incultivables [17, 20-22, 39 ] et appartiennent à la bactérie Bacteroidetes et Firmicutes identifié M faucium dans 1 spécimen Dans notre étude précédente, M faucium a été détecté dans 3 des 20 spécimens 15% et était donc considéré comme un agent abcès cérébral assez commun [23], ce qui a incité le développement d’un test de PCR spécifique Cependant, dans la présente série, seulement 1 échantillon était positif pour M faucium 19%. Cette différence, qui est presque significative P = 06, résulte probablement des différences d’échantillonnage Après combinaison des données des deux études, nous avons observé que M faucium était significativement retrouvé dans les échantillons polymicrobiens P = 02 et chez les patients présentant des anomalies sinusales ou dentaires P = 01 Bien que cette bactérie ne soit pas sensible au traitement empirique usuel des abcès cérébraux [40], Les 4 patients infectés par M faucium dans notre série ont été récupérés sans aucun traitement spécifique. En combinaison avec notre étude précédente [23], l’analyse métagénomique des séquences d’ADNr 16S amplifiées à partir d’abcès cérébraux de 71 patients s’est révélée être un outil extrêmement puissant. n’avait pas été détectée auparavant dans ces infections, dont 37 sont encore non cultivées, et soulignant que les flores sinusales et dentaires étaient la principale source de nouveaux taxons bactériens dans les abcès cérébraux

Remarques

Aide financière

Ce travail a été soutenu par le Programme National Hospitalier de Recherche Clinique « Etude Métagénomique des Abcès Cérébraux ».

Conflits d’intérêts potentiels

Tous les auteurs: Aucun conflit rapporté Tous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits d’intérêts potentiels Conflits que les éditeurs considèrent pertinents pour le contenu du manuscrit ont été divulgués